Abstract
The C family of short, interspersed repeats (SINES) is highly repeated in the rabbit genome, and most members have a structure suggestive of a model for their dispersal via reinsertion of a double-stranded copy of an RNA polymerase III transcribed RNA. We have determined the nucleotide sequence of additional members of the repeat family and have compiled them to obtain an improved consensus sequence. This compilation shows that although most regions of the repeat are well conserved, two regions show high variability. Some individual repeats are truncated, and one truncated repeat retains the characteristic structures of a retroposon. The consensus sequence for C repeats does not match the sequence of any other sequenced mammalian SINE over large regions, but short imperfect matches to several primate and rodent SINES are observed. A sequence similar to the 27 nucleotide consensus sequence . TCCCAGCAACCCACATGGGATGGCATGAGA was found in all mammalian SINES examined. The 3′ portion of this sequence matches a DNA segment found at the replication origins of papovaviruses.
| Original language | English (US) |
|---|---|
| Pages (from-to) | 1073-1088 |
| Number of pages | 16 |
| Journal | Nucleic acids research |
| Volume | 13 |
| Issue number | 4 |
| DOIs | |
| State | Published - Feb 25 1985 |
Fingerprint
All Science Journal Classification (ASJC) codes
- Genetics
Cite this
}
Variability within the rabbit C repeats and sequene shared with other SINES. / Hardison, Ross C.; Printz, Richard.
In: Nucleic acids research, Vol. 13, No. 4, 25.02.1985, p. 1073-1088.Research output: Contribution to journal › Article
TY - JOUR
T1 - Variability within the rabbit C repeats and sequene shared with other SINES
AU - Hardison, Ross C.
AU - Printz, Richard
PY - 1985/2/25
Y1 - 1985/2/25
N2 - The C family of short, interspersed repeats (SINES) is highly repeated in the rabbit genome, and most members have a structure suggestive of a model for their dispersal via reinsertion of a double-stranded copy of an RNA polymerase III transcribed RNA. We have determined the nucleotide sequence of additional members of the repeat family and have compiled them to obtain an improved consensus sequence. This compilation shows that although most regions of the repeat are well conserved, two regions show high variability. Some individual repeats are truncated, and one truncated repeat retains the characteristic structures of a retroposon. The consensus sequence for C repeats does not match the sequence of any other sequenced mammalian SINE over large regions, but short imperfect matches to several primate and rodent SINES are observed. A sequence similar to the 27 nucleotide consensus sequence . TCCCAGCAACCCACATGGGATGGCATGAGA was found in all mammalian SINES examined. The 3′ portion of this sequence matches a DNA segment found at the replication origins of papovaviruses.
AB - The C family of short, interspersed repeats (SINES) is highly repeated in the rabbit genome, and most members have a structure suggestive of a model for their dispersal via reinsertion of a double-stranded copy of an RNA polymerase III transcribed RNA. We have determined the nucleotide sequence of additional members of the repeat family and have compiled them to obtain an improved consensus sequence. This compilation shows that although most regions of the repeat are well conserved, two regions show high variability. Some individual repeats are truncated, and one truncated repeat retains the characteristic structures of a retroposon. The consensus sequence for C repeats does not match the sequence of any other sequenced mammalian SINE over large regions, but short imperfect matches to several primate and rodent SINES are observed. A sequence similar to the 27 nucleotide consensus sequence . TCCCAGCAACCCACATGGGATGGCATGAGA was found in all mammalian SINES examined. The 3′ portion of this sequence matches a DNA segment found at the replication origins of papovaviruses.
UR - http://www.scopus.com/inward/record.url?scp=0022431896&partnerID=8YFLogxK
UR - http://www.scopus.com/inward/citedby.url?scp=0022431896&partnerID=8YFLogxK
U2 - 10.1093/nar/13.4.1073
DO - 10.1093/nar/13.4.1073
M3 - Article
C2 - 4000935
AN - SCOPUS:0022431896
VL - 13
SP - 1073
EP - 1088
JO - Nucleic Acids Research
JF - Nucleic Acids Research
SN - 0305-1048
IS - 4
ER -